Trypanosoma evansi em cães de Barão de Melgaço, Mato Grosso : prevalência molecular e fatores de risco

Abstract

The hemoflagellate pathogen Trypanosoma evansi, the etiological agent of the disease known as “surra” or “mal das cadeiras”, is a protozoan that infects several mammals around the world, mainly affecting horses, camels, dogs, and wild animals. In the Brazilian Pantanal region, cases of canine trypanosomiasis caused by T. evansi have already been reported. The objective of this study was to identify the prevalence of T. evansi in dogs originating from a municipality located in the Pantanal of Mato Grosso and to investigate the possible risk factors associated with the infection. This research was carried out in the municipality of Barão de Melgaço (16011'40''S and 55058'03'' W), in the Pantanal of the state of Mato Grosso, Brazil, with dog blood samples. Epidemiological questionnaire applied to the tutor containing information about possible risk factors. The detection of T. evansi DNA was performed by the qPCR technique with species-specific primers (TevF:5'TGCAGACGACCTGACGCTACT-3' and TevR: 5'CTCCTAGAAGCTTCGGTGTCCT – 3') that amplified a portion of 227 base pairs of the surface glycoprotein variant (VSG) T. evansi Rode Trypanozoon (RoTat) 1.2. Of the 403 samples, in two (prevalence of 0.5%) genetic material of T. evansi was detected. Although no risk factor was associated with infection (p > 0.05), proximity to vegetation and streams, presence of tabanids, rodents and marsupials, was observed in the homes of positive dogs. These factors are known to be related to the occurrence of the infection. This information suggests that the municipality of Barão de Melgaço has epidemiological characteristics that allow canine infection by T. evansi.